A nucleic acid fluorescent probe is a form of nucleic acid probe that labels specific nucleic acid probes with fluorescent groups and analyzes and detects corresponding target molecules by recording changes in fluorescence signals. With the continuous development of chemical synthesis of nucleic acid technology, using nucleic acid probes for related research has become one of the most commonly used molecular biology techniques. Nucleic acid fluorescent probes have significant advantages such as high analytical sensitivity, simple detection methods, and minimal impact on biological molecules. They have been widely used for precise detection of protein molecules, nucleic acid fragment molecules, small biological molecules, and inorganic ions.
Modified primers are one of the advantageous service products of DeAoPing in the past 10 years. They adopt commercial and industrial production processes of nucleotides, implement a 100000 level clean room, strictly follow the ISO13485:2016 quality management system to carry out quality control throughout the entire production process, effectively control external pollution, and maximize the stability and traceability of batches. De Aoping Biotechnology has the world's leading chemical synthesis technology and automated production equipment. Based on customer design sequences or modification requirements, we can provide customized synthesis services for high stability, high quality, and g-grade ultra pure primer probes. At present, it has provided professional services and precise solutions for more than 100 molecular diagnosis, Genetic testing and nucleic acid drug enterprises.
Customized synthesis service for nucleic acid fluorescent probes
The most commonly used nucleic acid fluorescence probes are artificially synthesized oligonucleotide probes. According to different fluorescence signal output angles, DeOPIN can provide flexible customized synthesis services, including Taqman probes, MGB probes, MB probes, chain displacement probes, sandwich probes, etc.
Part.1
DIA-UP BIOTECH
Technical advantages
① Good uniformity, ensuring equal levels of synthesis for different sequences
② Stable synthesis, precise delivery, with an average success rate of over 98% for synthesis
③ Small molecular weight deviation, with an average UPLC purity of 94.7% and better repeatability
④ Flexible customized services that provide multiple types of decoration
⑤ Adopt 100000 level purification room to strictly control exogenous pollution and Confounding
⑥ More than 10 years of mature primer synthesis technology platform and optimized HPLC purification process
⑦ Strictly implement the ISO13485:2016 quality management system specifications to maximize batch stability and usage safety
Part.2
DIA-UP BIOTECH
Performance Data Analysis

➦ sequence
(FAM)AGCACGTGGGAGGGCGATCG(BHQ1)
➦ Mass spectrometry - molecular weight 7339.6

➦ UPLC detection - purity 93.57%

Part.3
DIA-UP BIOTECH
Deopin nucleic acid fluorescence probe product

Figure cited from:Nutiu R, Li Y. structure-switching signaling aptamers[J].Journal of the American Chemical Society. 2003,125(16): 4771-4778
For inquiries about IVD raw materials and research services related products, please contact us through the following methods——
Tel : 185 1363 7192 / 186 1089 6066
E-mile : order@dia-up.com
Add : Building 18, Yard 2, Huanke Middle Road, Tongzhou District, Beijing
DIA-UP was established in 2012, with a professional
technical research and development team with over 10 years of
experience, and has won multiple invention patents.
The company has built a research and development platform for in vitro
diagnostic materials (covering 10 major product systems, including
primer and probe synthesis, nucleic acid molecular detection materials,
immune reagent materials, biochemical reagent materials,
hemagglutination reagent materials, fluorescent immunochromatography
POCT large plate, biochemical reagent large package, hemagglutination
reagent large package, calibration quality control products, etc.),
automated high-throughput DNA reading and writing platform, RNA
Intelligent design and synthesis platform, protein antibody preparation
platform Five core technology platforms, including the supply platform for scientific research reagents and consumables.
DIA-UP adopts a 100000/10000 level
purification workshop for product production and packaging, strictly
adhering to the ISO13485:2016 quality management system standards,
adhering to the development concept of 'craftsmanship quality, customer
achievement', and committed to providing high-quality products and
services to customers in the field of in vitro diagnosis and research.