Stable, Accurate, Ling, Pure | DIA-UP Nucleic Acid Fluorescent Probe, Fully Assisted in Molecular Diagnosis Applications

Release Time:

2023-07-24

A nucleic acid fluorescent probe is a form of nucleic acid probe that labels specific nucleic acid probes with fluorescent groups and analyzes and detects corresponding target molecules by recording changes in fluorescence signals. With the continuous development of chemical synthesis of nucleic acid technology, using nucleic acid probes for related research has become one of the most commonly used molecular biology techniques. Nucleic acid fluorescent probes have significant advantages such as high analytical sensitivity, simple detection methods, and minimal impact on biological molecules. They have been widely used for precise detection of protein molecules, nucleic acid fragment molecules, small biological molecules, and inorganic ions.


Stable, Accurate, Ling, Pure | DeAoPing Nucleic Acid Fluorescent Probe, Fully Assisted in Molecular


Modified primers are one of the advantageous service products of DeAoPing in the past 10 years. They adopt commercial and industrial production processes of nucleotides, implement a 100000 level clean room, strictly follow the ISO13485:2016 quality management system to carry out quality control throughout the entire production process, effectively control external pollution, and maximize the stability and traceability of batches. De Aoping Biotechnology has the world's leading chemical synthesis technology and automated production equipment. Based on customer design sequences or modification requirements, we can provide customized synthesis services for high stability, high quality, and g-grade ultra pure primer probes. At present, it has provided professional services and precise solutions for more than 100 molecular diagnosis, Genetic testing and nucleic acid drug enterprises.


Diopin

Customized synthesis service for nucleic acid fluorescent probes


The most commonly used nucleic acid fluorescence probes are artificially synthesized oligonucleotide probes. According to different fluorescence signal output angles, DeOPIN can provide flexible customized synthesis services, including Taqman probes, MGB probes, MB probes, chain displacement probes, sandwich probes, etc.


Part.1

DIA-UP BIOTECH

Technical advantages


① Good uniformity, ensuring equal levels of synthesis for different sequences

② Stable synthesis, precise delivery, with an average success rate of over 98% for synthesis

③ Small molecular weight deviation, with an average UPLC purity of 94.7% and better repeatability

④ Flexible customized services that provide multiple types of decoration

⑤ Adopt 100000 level purification room to strictly control exogenous pollution and Confounding

⑥ More than 10 years of mature primer synthesis technology platform and optimized HPLC purification process

⑦ Strictly implement the ISO13485:2016 quality management system specifications to maximize batch stability and usage safety


Part.2

DIA-UP BIOTECH

Performance Data Analysis


Taqman probe 


Stable, Accurate, Ling, Pure | DeAoPing Nucleic Acid Fluorescent Probe, Fully Assisted in Molecular

➦ sequence 

(FAM)AGCACGTGGGAGGGCGATCG(BHQ1)

➦ Mass spectrometry - molecular weight 7339.6

Stable, Accurate, Ling, Pure | DeAoPing Nucleic Acid Fluorescent Probe, Fully Assisted in Molecular


➦ UPLC detection - purity 93.57%

Stable, Accurate, Ling, Pure | DeAoPing Nucleic Acid Fluorescent Probe, Fully Assisted in Molecular



Part.3

DIA-UP BIOTECH

Deopin nucleic acid fluorescence probe product


Stable, Accurate, Ling, Pure | DeAoPing Nucleic Acid Fluorescent Probe, Fully Assisted in Molecular

Figure cited from:Nutiu R, Li Y. structure-switching signaling aptamers[J].Journal of the American Chemical Society. 2003,125(16): 4771-4778


For inquiries about IVD raw materials and research services related products, please contact us through the following methods——


Stable, Accurate, Ling, Pure | DeAoPing Nucleic Acid Fluorescent Probe, Fully Assisted in Molecular

Tel : 185 1363 7192 / 186 1089 6066

E-mile : order@dia-up.com

Add : Building 18, Yard 2, Huanke Middle Road, Tongzhou District, Beijing

  

DIA-UP

BIOTECH


DIA-UP was established in 2012, with a professional technical research and development team with over 10 years of experience, and has won multiple invention patents. The company has built a research and development platform for in vitro diagnostic materials (covering 10 major product systems, including primer and probe synthesis, nucleic acid molecular detection materials, immune reagent materials, biochemical reagent materials, hemagglutination reagent materials, fluorescent immunochromatography POCT large plate, biochemical reagent large package, hemagglutination reagent large package, calibration quality control products, etc.), automated high-throughput DNA reading and writing platform, RNA Intelligent design and synthesis platform, protein antibody preparation platform Five core technology platforms, including the supply platform for scientific research reagents and consumables.


DIA-UP adopts a 100000/10000 level purification workshop for product production and packaging, strictly adhering to the ISO13485:2016 quality management system standards, adhering to the development concept of 'craftsmanship quality, customer achievement', and committed to providing high-quality products and services to customers in the field of in vitro diagnosis and research.

Related Recommend

Deep thinking | The technology of large fragments and high difficulty rapid gene synthesis oF DIA-UP
Large segment DNA synthesis technology is one of t...
Stable, Accurate, Ling, Pure | DIA-UP Nucleic Acid Fluorescent Probe, Fully Assisted in Molecular
A nucleic acid fluorescent probe is a form of nucl...
Upcoming | Revealing the Road to Advancing the New Second Generation Endocrine Factor Proteins of DI
Intrinsic factorIt is a glycoprotein secreted by t...
Fluorescence immunochromatography unlocks different tumor marker assays!
The commonly used techniques for tumor marker dete...