Problems of Traditional sgRNA:
sgRNA produced by methods such as in vitro transcription suffers from unstable preparation success rates. Additionally, its phosphorylated modifications can induce cytotoxicity and immune responses, imposing certain limitations on its application.
Significant Advantages of Chemically Synthesized sgRNA:
It effectively overcomes the limitations of traditional sgRNA, offering the following benefits:
Higher editing efficiency
Higher Purity
Lower cytotoxicity
Fewer off-target side effects
Flexible modification options for enhanced in vivo stability
Excellent batch-to-batch consistency
RNA Custom Chemical Synthesis of sgRNA
DIA-UP BIOTECH has established a mature chemical synthesis platform for sgRNA, providing customized sgRNA synthesis
services with high purity, stability, low toxicity, and rapid delivery. It is the ideal solution to address challenges such as low
gene editing efficiency and high time/labor costs in research.
Industry-Leading Synthesis Capabilities
✓ 93-103nt
Diversified Purification Methods for High Purity
✓ Desalting Purification 40-50%
✓ HPLC>90%
Flexible Modifications to Enhance Stability and Editing Efficiency
✓ DIA-UP BIOTECH adds three thiophosphate and methoxy modifications to both the 3' and 5' ends of sgRNA, maximizing the stability of sgRNA, prolonging its in vivo half-life, and preventing it from being degraded by exonucleases in the body. Compared with unmodified sgRNA, chemical modification can significantly improve the editing efficiency of the CRISPR system.
Stringent Quality Control (QC) Management System
✓ Each sgRNA undergoes mass spectrometry (MS) detection to ensure 100% sequence accuracy.
Stable Synthesis Processes Ensure Batch Consistency
Fast Delivery Cycle Reduces Time Costs: 5–7 Days
sgRNA Synthesis Service Cases
Chemically synthesized sgRNA is an RNA sequence of 97-103 bases, which contains a 17-23 base guide sequenc (Spacer) and
an 80 nucleotide scaffold sequence. The guide sequence is complementary to the target DNA, determining the targeting
specificity. The scaffold sequence binds to the Cas protein to form an sgRNA Cas9 complex, activating the targeting and
cleavage of Cas9.
Chemically synthesized sgRNA contains three 2'-O-methyl nucleotides with phosphorothioate bond modifications at both
ends,which improve the chemical stability of RNA, prolong the in vivo half-life, and significantly enhance the editing
efficiency of the CRISPR system, as shown in the figure below:
(mA)* (mU)*(mG)*UCACAGACAAGUACUCCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU*(mU)*(mU)*(mU)
Mass - Molecular Weight 32947.7
BEIJING DIA-UP BIOTECHNOLOGIES CO.,LTD
Sales hotline：+86185 1363 7053
Service hotline：+86185 1363 7192
After-sales hotline：+86185 1363 7531
Order Email：order@dia-up.com
After-sales Email：service@dia-up.com
Official website：www.dia-up.com
Company Add：Building 18, No. 2, Huankexizhong Road, Tongzhou District, Beijing